|
Azenta
chip pcr Chip Pcr, supplied by Azenta, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/chip+pcr/pmc12490252__mmc2-258-0-2?v=Azenta Average 86 stars, based on 1 article reviews
chip pcr - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Advanced Liquid Logic Inc
real-time pcr lab-on-a-chip ![]() Real Time Pcr Lab On A Chip, supplied by Advanced Liquid Logic Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/chip+pcr/pmc02854258-53-10-0?v=Advanced+Liquid+Logic+Inc Average 90 stars, based on 1 article reviews
real-time pcr lab-on-a-chip - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
CLONDIAG chip technologies GmbH
pcr products ![]() Pcr Products, supplied by CLONDIAG chip technologies GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/chip+pcr/10__1128_slash_jcm__43__3__1024___1031__2005-78-1-26?v=CLONDIAG+chip+technologies+GmbH Average 90 stars, based on 1 article reviews
pcr products - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Biolegio bv
primer for chip-pcr ![]() Primer For Chip Pcr, supplied by Biolegio bv, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/chip+pcr/pmc10338301-95-9-5?v=Biolegio+bv Average 90 stars, based on 1 article reviews
primer for chip-pcr - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
ZytoVision gmbh
pcr array zytovision visionarray chip ![]() Pcr Array Zytovision Visionarray Chip, supplied by ZytoVision gmbh, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/chip+pcr/pm33175427-1598-15-17?v=ZytoVision+gmbh Average 90 stars, based on 1 article reviews
pcr array zytovision visionarray chip - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
COMSOL Inc
pf-pcr chip ![]() Pf Pcr Chip, supplied by COMSOL Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/chip+pcr/pm34008961__nn1c02154_si_001-39-8-13?v=COMSOL+Inc Average 90 stars, based on 1 article reviews
pf-pcr chip - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Ribobio co
chip-pcr primers ![]() Chip Pcr Primers, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/chip+pcr/pm35773668-164-0-15?v=Ribobio+co Average 90 stars, based on 1 article reviews
chip-pcr primers - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
GraphPad Software Inc
chip-pcr reaction ![]() Chip Pcr Reaction, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/chip+pcr/pm27496319-249-4-21?v=GraphPad+Software+Inc Average 90 stars, based on 1 article reviews
chip-pcr reaction - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Active Motif
chip-pcr ![]() Chip Pcr, supplied by Active Motif, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/chip+pcr/pmc05551553-32-13-5?v=Active+Motif Average 90 stars, based on 1 article reviews
chip-pcr - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Bigtec Private Limited
devices for extracting rna and chip-for hiv-1 and hiv-2 in micro-pcr ![]() Devices For Extracting Rna And Chip For Hiv 1 And Hiv 2 In Micro Pcr, supplied by Bigtec Private Limited, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/chip+pcr/pmc11018814-207-14-0?v=Bigtec+Private+Limited Average 90 stars, based on 1 article reviews
devices for extracting rna and chip-for hiv-1 and hiv-2 in micro-pcr - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Active Motif
chip-pcr kit specifications ![]() Chip Pcr Kit Specifications, supplied by Active Motif, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/chip+pcr/pmc05364626__12864_2017_3628_MOESM3_ESM-80-20-23?v=Active+Motif Average 90 stars, based on 1 article reviews
chip-pcr kit specifications - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Biolegio bv
primer for chip-pcr il-6 forward agggagagccagaacacaga ![]() Primer For Chip Pcr Il 6 Forward Agggagagccagaacacaga, supplied by Biolegio bv, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/chip+pcr/pmc10338301-100-8-4?v=Biolegio+bv Average 90 stars, based on 1 article reviews
primer for chip-pcr il-6 forward agggagagccagaacacaga - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal:
Article Title: Microfluidic Platform versus Conventional Real-time PCR for the Detection of Mycoplasma pneumoniae in Respiratory Specimens
doi: 10.1016/j.diagmicrobio.2009.12.020
Figure Lengend Snippet: Precision of the microfluidic real-time PCR platform using simulated clinical samples at 10 4 CFU/mL
Article Snippet:
Techniques: Real-time Polymerase Chain Reaction
Journal:
Article Title: Microfluidic Platform versus Conventional Real-time PCR for the Detection of Mycoplasma pneumoniae in Respiratory Specimens
doi: 10.1016/j.diagmicrobio.2009.12.020
Figure Lengend Snippet: Comparison of real-time PCR results of acute patient NPWs on conventional and microfluidic real-time PCR platforms
Article Snippet:
Techniques: Comparison, Real-time Polymerase Chain Reaction