|
Azenta
chip pcr Chip Pcr, supplied by Azenta, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/chip pcr/product/Azenta Average 86 stars, based on 1 article reviews
chip pcr - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
|
COMSOL Inc
thermal model of the cross-sectional pf-pcr chip Thermal Model Of The Cross Sectional Pf Pcr Chip, supplied by COMSOL Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/thermal model of the cross-sectional pf-pcr chip/product/COMSOL Inc Average 90 stars, based on 1 article reviews
thermal model of the cross-sectional pf-pcr chip - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
AITBIOTECH Pte Ltd
chip qrt-pcr promoter primer sequences Chip Qrt Pcr Promoter Primer Sequences, supplied by AITBIOTECH Pte Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/chip qrt-pcr promoter primer sequences/product/AITBIOTECH Pte Ltd Average 90 stars, based on 1 article reviews
chip qrt-pcr promoter primer sequences - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Active Motif
chip-pcr kit specifications Chip Pcr Kit Specifications, supplied by Active Motif, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/chip-pcr kit specifications/product/Active Motif Average 90 stars, based on 1 article reviews
chip-pcr kit specifications - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Biolegio bv
primer for chip-pcr il-6 forward agggagagccagaacacaga Primer For Chip Pcr Il 6 Forward Agggagagccagaacacaga, supplied by Biolegio bv, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer for chip-pcr il-6 forward agggagagccagaacacaga/product/Biolegio bv Average 90 stars, based on 1 article reviews
primer for chip-pcr il-6 forward agggagagccagaacacaga - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
COMSOL Inc
pf-pcr chip Pf Pcr Chip, supplied by COMSOL Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pf-pcr chip/product/COMSOL Inc Average 90 stars, based on 1 article reviews
pf-pcr chip - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Ribobio co
chip-pcr primers Chip Pcr Primers, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/chip-pcr primers/product/Ribobio co Average 90 stars, based on 1 article reviews
chip-pcr primers - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Advanced Liquid Logic Inc
real-time pcr lab-on-a-chip ![]() Real Time Pcr Lab On A Chip, supplied by Advanced Liquid Logic Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/real-time pcr lab-on-a-chip/product/Advanced Liquid Logic Inc Average 90 stars, based on 1 article reviews
real-time pcr lab-on-a-chip - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
ZytoVision gmbh
pcr array zytovision visionarray chip ![]() Pcr Array Zytovision Visionarray Chip, supplied by ZytoVision gmbh, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pcr array zytovision visionarray chip/product/ZytoVision gmbh Average 90 stars, based on 1 article reviews
pcr array zytovision visionarray chip - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Biolegio bv
primer for chip-pcr ![]() Primer For Chip Pcr, supplied by Biolegio bv, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer for chip-pcr/product/Biolegio bv Average 90 stars, based on 1 article reviews
primer for chip-pcr - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
CLONDIAG chip technologies GmbH
pcr products ![]() Pcr Products, supplied by CLONDIAG chip technologies GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pcr products/product/CLONDIAG chip technologies GmbH Average 90 stars, based on 1 article reviews
pcr products - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Panasonic Healthcare
pcr chip ![]() Pcr Chip, supplied by Panasonic Healthcare, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pcr chip/product/Panasonic Healthcare Average 90 stars, based on 1 article reviews
pcr chip - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal:
Article Title: Microfluidic Platform versus Conventional Real-time PCR for the Detection of Mycoplasma pneumoniae in Respiratory Specimens
doi: 10.1016/j.diagmicrobio.2009.12.020
Figure Lengend Snippet: Precision of the microfluidic real-time PCR platform using simulated clinical samples at 10 4 CFU/mL
Article Snippet:
Techniques: Real-time Polymerase Chain Reaction
Journal:
Article Title: Microfluidic Platform versus Conventional Real-time PCR for the Detection of Mycoplasma pneumoniae in Respiratory Specimens
doi: 10.1016/j.diagmicrobio.2009.12.020
Figure Lengend Snippet: Comparison of real-time PCR results of acute patient NPWs on conventional and microfluidic real-time PCR platforms
Article Snippet:
Techniques: Comparison, Real-time Polymerase Chain Reaction
Journal: Materials Today Bio
Article Title: Transformation gap from research findings to large-scale commercialized products in microfluidic field
doi: 10.1016/j.mtbio.2024.101373
Figure Lengend Snippet: Research findings and commercialized products of end-to-end materials—silicon-based and glass-based microfluidic chips. (A) A microreactor for high-temperature catalytic partial oxidation gas phase reactions made of silicon . (B) PCR chip made by IMEC and Panasonic, based on a silicon-based microfluidic platform . (C) Glass-based microfluidic device used for Raman image-activated cell sorting . (D) Illumina BeadArray chip . (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)
Article Snippet: Research findings and commercialized products of end-to-end materials—silicon-based and glass-based microfluidic chips. (A) A microreactor for high-temperature catalytic partial oxidation gas phase reactions made of silicon [ ]. (B)
Techniques: FACS
Journal: Materials Today Bio
Article Title: Transformation gap from research findings to large-scale commercialized products in microfluidic field
doi: 10.1016/j.mtbio.2024.101373
Figure Lengend Snippet: Droplet digital PCR: (A) Manipulations with droplet microfluidics . (a) A droplet-producing device. (b) One million droplets stored in a 200 μL microtube. (c) A reinjection device. (d) A picoinjection device. (e) A splitting device. (f) A sorting device. Rain Dance's (B) chip structure and (C) product .
Article Snippet: Research findings and commercialized products of end-to-end materials—silicon-based and glass-based microfluidic chips. (A) A microreactor for high-temperature catalytic partial oxidation gas phase reactions made of silicon [ ]. (B)
Techniques: Digital PCR