chip pcr Search Results


86
Azenta chip pcr
Chip Pcr, supplied by Azenta, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/chip pcr/product/Azenta
Average 86 stars, based on 1 article reviews
chip pcr - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

90
COMSOL Inc thermal model of the cross-sectional pf-pcr chip
Thermal Model Of The Cross Sectional Pf Pcr Chip, supplied by COMSOL Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/thermal model of the cross-sectional pf-pcr chip/product/COMSOL Inc
Average 90 stars, based on 1 article reviews
thermal model of the cross-sectional pf-pcr chip - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
AITBIOTECH Pte Ltd chip qrt-pcr promoter primer sequences
Chip Qrt Pcr Promoter Primer Sequences, supplied by AITBIOTECH Pte Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/chip qrt-pcr promoter primer sequences/product/AITBIOTECH Pte Ltd
Average 90 stars, based on 1 article reviews
chip qrt-pcr promoter primer sequences - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Active Motif chip-pcr kit specifications
Chip Pcr Kit Specifications, supplied by Active Motif, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/chip-pcr kit specifications/product/Active Motif
Average 90 stars, based on 1 article reviews
chip-pcr kit specifications - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Biolegio bv primer for chip-pcr il-6 forward agggagagccagaacacaga
Primer For Chip Pcr Il 6 Forward Agggagagccagaacacaga, supplied by Biolegio bv, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer for chip-pcr il-6 forward agggagagccagaacacaga/product/Biolegio bv
Average 90 stars, based on 1 article reviews
primer for chip-pcr il-6 forward agggagagccagaacacaga - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
COMSOL Inc pf-pcr chip
Pf Pcr Chip, supplied by COMSOL Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pf-pcr chip/product/COMSOL Inc
Average 90 stars, based on 1 article reviews
pf-pcr chip - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Ribobio co chip-pcr primers
Chip Pcr Primers, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/chip-pcr primers/product/Ribobio co
Average 90 stars, based on 1 article reviews
chip-pcr primers - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Advanced Liquid Logic Inc real-time pcr lab-on-a-chip
Precision of the microfluidic real-time <t> PCR </t> platform using simulated clinical samples at 10 4 CFU/mL
Real Time Pcr Lab On A Chip, supplied by Advanced Liquid Logic Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/real-time pcr lab-on-a-chip/product/Advanced Liquid Logic Inc
Average 90 stars, based on 1 article reviews
real-time pcr lab-on-a-chip - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
ZytoVision gmbh pcr array zytovision visionarray chip
Precision of the microfluidic real-time <t> PCR </t> platform using simulated clinical samples at 10 4 CFU/mL
Pcr Array Zytovision Visionarray Chip, supplied by ZytoVision gmbh, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcr array zytovision visionarray chip/product/ZytoVision gmbh
Average 90 stars, based on 1 article reviews
pcr array zytovision visionarray chip - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Biolegio bv primer for chip-pcr
Precision of the microfluidic real-time <t> PCR </t> platform using simulated clinical samples at 10 4 CFU/mL
Primer For Chip Pcr, supplied by Biolegio bv, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer for chip-pcr/product/Biolegio bv
Average 90 stars, based on 1 article reviews
primer for chip-pcr - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
CLONDIAG chip technologies GmbH pcr products
Precision of the microfluidic real-time <t> PCR </t> platform using simulated clinical samples at 10 4 CFU/mL
Pcr Products, supplied by CLONDIAG chip technologies GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcr products/product/CLONDIAG chip technologies GmbH
Average 90 stars, based on 1 article reviews
pcr products - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Panasonic Healthcare pcr chip
Research findings and commercialized products of end-to-end materials—silicon-based and glass-based microfluidic chips. (A) A microreactor for <t>high-temperature</t> <t>catalytic</t> partial oxidation gas phase reactions made of silicon . (B) <t>PCR</t> chip made by IMEC and Panasonic, based on a silicon-based microfluidic platform . (C) Glass-based microfluidic device used for Raman image-activated cell sorting . (D) Illumina BeadArray chip . (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)
Pcr Chip, supplied by Panasonic Healthcare, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcr chip/product/Panasonic Healthcare
Average 90 stars, based on 1 article reviews
pcr chip - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

Image Search Results


Precision of the microfluidic real-time  PCR  platform using simulated clinical samples at 10 4 CFU/mL

Journal:

Article Title: Microfluidic Platform versus Conventional Real-time PCR for the Detection of Mycoplasma pneumoniae in Respiratory Specimens

doi: 10.1016/j.diagmicrobio.2009.12.020

Figure Lengend Snippet: Precision of the microfluidic real-time PCR platform using simulated clinical samples at 10 4 CFU/mL

Article Snippet: Advanced Liquid Logic, Inc. ( http://www.liquid-logic.com/ ) has developed an innovative real-time PCR lab-on-a-chip technology to detect microbial DNA in clinical specimens.

Techniques: Real-time Polymerase Chain Reaction

Comparison of real-time  PCR  results of acute patient NPWs on conventional and microfluidic real-time  PCR  platforms

Journal:

Article Title: Microfluidic Platform versus Conventional Real-time PCR for the Detection of Mycoplasma pneumoniae in Respiratory Specimens

doi: 10.1016/j.diagmicrobio.2009.12.020

Figure Lengend Snippet: Comparison of real-time PCR results of acute patient NPWs on conventional and microfluidic real-time PCR platforms

Article Snippet: Advanced Liquid Logic, Inc. ( http://www.liquid-logic.com/ ) has developed an innovative real-time PCR lab-on-a-chip technology to detect microbial DNA in clinical specimens.

Techniques: Comparison, Real-time Polymerase Chain Reaction

Research findings and commercialized products of end-to-end materials—silicon-based and glass-based microfluidic chips. (A) A microreactor for high-temperature catalytic partial oxidation gas phase reactions made of silicon . (B) PCR chip made by IMEC and Panasonic, based on a silicon-based microfluidic platform . (C) Glass-based microfluidic device used for Raman image-activated cell sorting . (D) Illumina BeadArray chip . (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

Journal: Materials Today Bio

Article Title: Transformation gap from research findings to large-scale commercialized products in microfluidic field

doi: 10.1016/j.mtbio.2024.101373

Figure Lengend Snippet: Research findings and commercialized products of end-to-end materials—silicon-based and glass-based microfluidic chips. (A) A microreactor for high-temperature catalytic partial oxidation gas phase reactions made of silicon . (B) PCR chip made by IMEC and Panasonic, based on a silicon-based microfluidic platform . (C) Glass-based microfluidic device used for Raman image-activated cell sorting . (D) Illumina BeadArray chip . (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

Article Snippet: Research findings and commercialized products of end-to-end materials—silicon-based and glass-based microfluidic chips. (A) A microreactor for high-temperature catalytic partial oxidation gas phase reactions made of silicon [ ]. (B) PCR chip made by IMEC and Panasonic, based on a silicon-based microfluidic platform [ ]. (C) Glass-based microfluidic device used for Raman image-activated cell sorting [ ]. (D) Illumina BeadArray chip [ ]. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

Techniques: FACS

Droplet digital PCR: (A) Manipulations with droplet microfluidics . (a) A droplet-producing device. (b) One million droplets stored in a 200 μL microtube. (c) A reinjection device. (d) A picoinjection device. (e) A splitting device. (f) A sorting device. Rain Dance's (B) chip structure and (C) product .

Journal: Materials Today Bio

Article Title: Transformation gap from research findings to large-scale commercialized products in microfluidic field

doi: 10.1016/j.mtbio.2024.101373

Figure Lengend Snippet: Droplet digital PCR: (A) Manipulations with droplet microfluidics . (a) A droplet-producing device. (b) One million droplets stored in a 200 μL microtube. (c) A reinjection device. (d) A picoinjection device. (e) A splitting device. (f) A sorting device. Rain Dance's (B) chip structure and (C) product .

Article Snippet: Research findings and commercialized products of end-to-end materials—silicon-based and glass-based microfluidic chips. (A) A microreactor for high-temperature catalytic partial oxidation gas phase reactions made of silicon [ ]. (B) PCR chip made by IMEC and Panasonic, based on a silicon-based microfluidic platform [ ]. (C) Glass-based microfluidic device used for Raman image-activated cell sorting [ ]. (D) Illumina BeadArray chip [ ]. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

Techniques: Digital PCR