chip pcr Search Results


86
Azenta chip pcr
Chip Pcr, supplied by Azenta, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/chip+pcr/pmc12490252__mmc2-258-0-2?v=Azenta
Average 86 stars, based on 1 article reviews
chip pcr - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

90
Advanced Liquid Logic Inc real-time pcr lab-on-a-chip
Precision of the microfluidic real-time <t> PCR </t> platform using simulated clinical samples at 10 4 CFU/mL
Real Time Pcr Lab On A Chip, supplied by Advanced Liquid Logic Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/chip+pcr/pmc02854258-53-10-0?v=Advanced+Liquid+Logic+Inc
Average 90 stars, based on 1 article reviews
real-time pcr lab-on-a-chip - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
CLONDIAG chip technologies GmbH pcr products
Precision of the microfluidic real-time <t> PCR </t> platform using simulated clinical samples at 10 4 CFU/mL
Pcr Products, supplied by CLONDIAG chip technologies GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/chip+pcr/10__1128_slash_jcm__43__3__1024___1031__2005-78-1-26?v=CLONDIAG+chip+technologies+GmbH
Average 90 stars, based on 1 article reviews
pcr products - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Biolegio bv primer for chip-pcr
Precision of the microfluidic real-time <t> PCR </t> platform using simulated clinical samples at 10 4 CFU/mL
Primer For Chip Pcr, supplied by Biolegio bv, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/chip+pcr/pmc10338301-95-9-5?v=Biolegio+bv
Average 90 stars, based on 1 article reviews
primer for chip-pcr - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
ZytoVision gmbh pcr array zytovision visionarray chip
Precision of the microfluidic real-time <t> PCR </t> platform using simulated clinical samples at 10 4 CFU/mL
Pcr Array Zytovision Visionarray Chip, supplied by ZytoVision gmbh, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/chip+pcr/pm33175427-1598-15-17?v=ZytoVision+gmbh
Average 90 stars, based on 1 article reviews
pcr array zytovision visionarray chip - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
COMSOL Inc pf-pcr chip
Precision of the microfluidic real-time <t> PCR </t> platform using simulated clinical samples at 10 4 CFU/mL
Pf Pcr Chip, supplied by COMSOL Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/chip+pcr/pm34008961__nn1c02154_si_001-39-8-13?v=COMSOL+Inc
Average 90 stars, based on 1 article reviews
pf-pcr chip - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Ribobio co chip-pcr primers
Precision of the microfluidic real-time <t> PCR </t> platform using simulated clinical samples at 10 4 CFU/mL
Chip Pcr Primers, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/chip+pcr/pm35773668-164-0-15?v=Ribobio+co
Average 90 stars, based on 1 article reviews
chip-pcr primers - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
GraphPad Software Inc chip-pcr reaction
Precision of the microfluidic real-time <t> PCR </t> platform using simulated clinical samples at 10 4 CFU/mL
Chip Pcr Reaction, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/chip+pcr/pm27496319-249-4-21?v=GraphPad+Software+Inc
Average 90 stars, based on 1 article reviews
chip-pcr reaction - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Active Motif chip-pcr
Precision of the microfluidic real-time <t> PCR </t> platform using simulated clinical samples at 10 4 CFU/mL
Chip Pcr, supplied by Active Motif, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/chip+pcr/pmc05551553-32-13-5?v=Active+Motif
Average 90 stars, based on 1 article reviews
chip-pcr - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Bigtec Private Limited devices for extracting rna and chip-for hiv-1 and hiv-2 in micro-pcr
Precision of the microfluidic real-time <t> PCR </t> platform using simulated clinical samples at 10 4 CFU/mL
Devices For Extracting Rna And Chip For Hiv 1 And Hiv 2 In Micro Pcr, supplied by Bigtec Private Limited, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/chip+pcr/pmc11018814-207-14-0?v=Bigtec+Private+Limited
Average 90 stars, based on 1 article reviews
devices for extracting rna and chip-for hiv-1 and hiv-2 in micro-pcr - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Active Motif chip-pcr kit specifications
Precision of the microfluidic real-time <t> PCR </t> platform using simulated clinical samples at 10 4 CFU/mL
Chip Pcr Kit Specifications, supplied by Active Motif, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/chip+pcr/pmc05364626__12864_2017_3628_MOESM3_ESM-80-20-23?v=Active+Motif
Average 90 stars, based on 1 article reviews
chip-pcr kit specifications - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Biolegio bv primer for chip-pcr il-6 forward agggagagccagaacacaga
Precision of the microfluidic real-time <t> PCR </t> platform using simulated clinical samples at 10 4 CFU/mL
Primer For Chip Pcr Il 6 Forward Agggagagccagaacacaga, supplied by Biolegio bv, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/chip+pcr/pmc10338301-100-8-4?v=Biolegio+bv
Average 90 stars, based on 1 article reviews
primer for chip-pcr il-6 forward agggagagccagaacacaga - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

Image Search Results


Precision of the microfluidic real-time  PCR  platform using simulated clinical samples at 10 4 CFU/mL

Journal:

Article Title: Microfluidic Platform versus Conventional Real-time PCR for the Detection of Mycoplasma pneumoniae in Respiratory Specimens

doi: 10.1016/j.diagmicrobio.2009.12.020

Figure Lengend Snippet: Precision of the microfluidic real-time PCR platform using simulated clinical samples at 10 4 CFU/mL

Article Snippet: Advanced Liquid Logic, Inc. ( http://www.liquid-logic.com/ ) has developed an innovative real-time PCR lab-on-a-chip technology to detect microbial DNA in clinical specimens.

Techniques: Real-time Polymerase Chain Reaction

Comparison of real-time  PCR  results of acute patient NPWs on conventional and microfluidic real-time  PCR  platforms

Journal:

Article Title: Microfluidic Platform versus Conventional Real-time PCR for the Detection of Mycoplasma pneumoniae in Respiratory Specimens

doi: 10.1016/j.diagmicrobio.2009.12.020

Figure Lengend Snippet: Comparison of real-time PCR results of acute patient NPWs on conventional and microfluidic real-time PCR platforms

Article Snippet: Advanced Liquid Logic, Inc. ( http://www.liquid-logic.com/ ) has developed an innovative real-time PCR lab-on-a-chip technology to detect microbial DNA in clinical specimens.

Techniques: Comparison, Real-time Polymerase Chain Reaction